View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21183_low_9 (Length: 337)
Name: NF21183_low_9
Description: NF21183
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21183_low_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 4 - 246
Target Start/End: Complemental strand, 441712 - 441470
Alignment:
| Q |
4 |
atctcgaagaatatgaaataaaataaaatttagcttcatttggattatcgaatcagattgaatgggtcacatgaaccctaaaacatctttaattgagaag |
103 |
Q |
| |
|
|||||||| || |||||||||||| || ||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||| |
|
|
| T |
441712 |
atctcgaataaattgaaataaaatagaagttagcttcatttggattatcgaatcagattgaatgggtcacctgtaccctaaaacatctttaattgagaag |
441613 |
T |
 |
| Q |
104 |
tctttttcaaaatttagattttggtataaaggtaacacaaaactcatgtttagttgtgttcatgggtgtggatcggcatacaaacctagtgagtcaaccc |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
441612 |
tctttttcaaaatttagattttggtataaaggtaacacacaactcatgtttagttgtgttcatgggtgtggatcggcatacaaacctagtgagtcaaccc |
441513 |
T |
 |
| Q |
204 |
gactcaacccacattacctaagcctaattatttatggatctat |
246 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
441512 |
gactcaacccacattgcctaagcctaattatttatggatctat |
441470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 6e-34
Query Start/End: Original strand, 242 - 319
Target Start/End: Complemental strand, 441022 - 440945
Alignment:
| Q |
242 |
tctattcttattattggtgggctagtacatattttttagattgaaggtgtctaatatgtgttgttatcacgggtttcc |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
441022 |
tctattcttattattggtgggctagtacatattttttagattgaaggtgtataatatgtgttgttatcacgggtttcc |
440945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University