View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_high_28 (Length: 282)
Name: NF21184_high_28
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_high_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 246; Significance: 1e-136; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 246; E-Value: 1e-136
Query Start/End: Original strand, 10 - 263
Target Start/End: Original strand, 50049109 - 50049362
Alignment:
| Q |
10 |
catcatcaacaagatcagcaatcaacatggacccaattgacatctctctgaaagctaactcgaatggagatgcccatgctgagtacaccaccaataccac |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50049109 |
catcaacaacaagatcagcaatcaacatggacccaattgacatctctctgaaagctaactcgaatggagatgcccatgctgagtacaccaccaataccac |
50049208 |
T |
 |
| Q |
110 |
taggaacgtttgccacaatctatatcacaaacttgtcattccacagcacaggatataaacaaataaattgtattaaggcaaattaaatatgtatgtacct |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50049209 |
taggaacgtttgccacaatctatatcacaaacttgtcattccacagcacaggatataaacaaataaattgtattaaggcaaattaaatatgtatgtacct |
50049308 |
T |
 |
| Q |
210 |
atatctgcgatcatagggagcaataacatattttttaaggtcgaagtaaccttc |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
50049309 |
atatctgcgatcatagggagcaataacatatttttttaggtcgaagtaaccttc |
50049362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University