View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_high_38 (Length: 247)
Name: NF21184_high_38
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_high_38 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 151; Significance: 5e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 151; E-Value: 5e-80
Query Start/End: Original strand, 17 - 247
Target Start/End: Complemental strand, 923865 - 923625
Alignment:
| Q |
17 |
aggagtatctcctacgcgtaacacacacttctgcgacagttttctattttgcatgtattagaaagagaagagattaattgattaagcaccgttaaatggt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| |
|
|
| T |
923865 |
aggagtatctcctacgcgtaacacacacttttgcgacagttttctattttgcatgtattagaaagagaagagattaattgattaattga--ttaaacggt |
923768 |
T |
 |
| Q |
117 |
ggtggaaacttcttgtacgtgt------------tcaaatcccacgtgatgtgttttctgacggagtgacaatcaatttccggataatttgttcttacat |
204 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
923767 |
ggtggaaacttcttgtacgtgtcattgtatgtgttcaaatcccacatgatgtgttttctgacggagtgacaatcaattttcagatactttgttcttacat |
923668 |
T |
 |
| Q |
205 |
gaaagacaagattggccgcaatatgtattgcactttggttatc |
247 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
923667 |
gaaagacaagattggccgcaatatgtattgcactttggttatc |
923625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University