View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_high_39 (Length: 245)
Name: NF21184_high_39
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_high_39 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 10 - 245
Target Start/End: Original strand, 2424228 - 2424463
Alignment:
| Q |
10 |
ggcatcacaatacgtattgatggtacactagttgcaacatccaactatggtgttattggaaatgaggggagttggttgctttttgatgatgttgatggag |
109 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2424228 |
ggcatcacagtacgtattgatggtacactagttgcaacatccaactatggtgtaattggaaatgaggggagttggttgctttttgatgatgttgatggag |
2424327 |
T |
 |
| Q |
110 |
tttcaattattggtggcatccttgatggtcaaggcacaagtttgtgggattgtaaaagatccggcaatagttgcccaaccggtgctacggtatagattta |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
2424328 |
tttcaattattggtggcatccttgatggtcaaggcacaagtttgtgggattgtaaaagatccagcaagagttgcccaactggtgctacggtatagattta |
2424427 |
T |
 |
| Q |
210 |
ctttcttaaaactttactaactttgtgttttatccc |
245 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
2424428 |
ctttcttaaaactttactaactttgtgttttatccc |
2424463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University