View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_high_43 (Length: 214)
Name: NF21184_high_43
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_high_43 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 6e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 6e-61
Query Start/End: Original strand, 18 - 197
Target Start/End: Complemental strand, 42182200 - 42182024
Alignment:
| Q |
18 |
atcaaagactatgtacttcaaccaaaataatggttttagtagnnnnnnnaggttagtttattaatccagtttcatttgcaacattaacaattacaaattg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||| ||| ||||||||||||||||||||||||||||||| |
|
|
| T |
42182200 |
atcaaagactatgtacttcaaccaaaataatggttt-agtagtttttttaggttagtttattaacccaatttcatttgcaacattaacaattacaaattg |
42182102 |
T |
|
| Q |
118 |
atacaaaatgaaccgataacctctaacattttattctttctattgctcgaaaaaataatcctttaattgtattttgtttt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||| | |||||||||||||| |
|
|
| T |
42182101 |
atacaaaatgaaccgataacct-taacattttattctttctattgctcg-aaaaataatccttcacttgtattttgtttt |
42182024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University