View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_low_32 (Length: 286)
Name: NF21184_low_32
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_low_32 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 257
Target Start/End: Complemental strand, 522202 - 521958
Alignment:
| Q |
19 |
tacttaacatatgaaaggtaatgtgaaatactttgctagtaaatactcaagtaagg-----acgctacttagagcatctccaatggtcatattttaaaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
522202 |
tacttaacatatgaaaggtaatgtgaaatactttgctagtaaatactcaagtaaagacgctacgctacttagagcatctccaatggtcatattttaaaga |
522103 |
T |
|
| Q |
114 |
actcactctgagtttcatacacttctatcaattggtcaccccaatgccacatcatacttatgaaactcatatacatttgctgtaatgat-aaaaaattat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
522102 |
actcactctgagtttcatacacttctatcaattggtcaccacaataccacatcatacttatgaaactcatatacatttgctgtaatgataaaaaaattat |
522003 |
T |
|
| Q |
213 |
gcaactcacgcatttatatttctttattagtatgaaacaaatttt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
522002 |
gcaactcacgcatttatatttctttattagtatgaaacaaatttt |
521958 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 155 - 191
Target Start/End: Complemental strand, 4309100 - 4309064
Alignment:
| Q |
155 |
caatgccacatcatacttatgaaactcatatacattt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4309100 |
caatgccacatcatacttatgaaactcatatccattt |
4309064 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 155 - 219
Target Start/End: Original strand, 9639242 - 9639306
Alignment:
| Q |
155 |
caatgccacatcatacttatgaaactcatatacatttgctgtaatgataaaaaattatgcaactc |
219 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||| | ||||||||| ||||||| ||||| |
|
|
| T |
9639242 |
caatgccacgtcatacttatgtaactcatacacattttattcaatgataaataattatgaaactc |
9639306 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University