View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_low_40 (Length: 250)
Name: NF21184_low_40
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_low_40 |
 |  |
|
| [»] chr3 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 2e-58; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 2e-58
Query Start/End: Original strand, 136 - 250
Target Start/End: Original strand, 24258898 - 24259012
Alignment:
| Q |
136 |
ttcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagtttttgttggatggtatattggattgcatccatgaaa |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258898 |
ttcatatgaagagaaacgaggattgtggaagaaagagtcaacaacctgggaaagccgggagagtttttgttggatggtatattggattgcatccatgaaa |
24258997 |
T |
 |
| Q |
236 |
tcacagttgcacttt |
250 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
24258998 |
tcacagttgcacttt |
24259012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 16 - 122
Target Start/End: Original strand, 24258767 - 24258872
Alignment:
| Q |
16 |
atattacaaaacaatcaaaccaaagattgnnnnnnncatcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
115 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24258767 |
atattacaaaacaatcaaaccaaagattgaaaaaa-catcatttgtatcattgtaataaataagaagaaaagtatactatagtatagtgatgaagtggta |
24258865 |
T |
 |
| Q |
116 |
gtgaaca |
122 |
Q |
| |
|
||||||| |
|
|
| T |
24258866 |
gtgaaca |
24258872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University