View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_low_42 (Length: 249)
Name: NF21184_low_42
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_low_42 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 1 - 204
Target Start/End: Original strand, 13320634 - 13320837
Alignment:
| Q |
1 |
attcacatgtttttctaccgtaacaaatgttaccttagcttgtaaagaaagtattagaaatcaaaagaaaccaatttaggtttgattaattggactcaag |
100 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13320634 |
attcacatgtttttccaccgtaacaaatgttaccttagcttgtaaagaaagtattagaaatcaaaagaaaccaatttaggtttgattaattggactcaag |
13320733 |
T |
|
| Q |
101 |
gaaaagataagttgttggcttgcacttcaactgctgccatgtcctcattttcttttgactattttccattttctaatgaaattcacccaacatatgctct |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||| |||||| |
|
|
| T |
13320734 |
gaaaagataagttgttggcttgcacttcaactgctgccatgtcctcattttcttttgactattttccattttcttattaaattcacccaacatttgctct |
13320833 |
T |
|
| Q |
201 |
catt |
204 |
Q |
| |
|
|||| |
|
|
| T |
13320834 |
catt |
13320837 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University