View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21184_low_45 (Length: 242)
Name: NF21184_low_45
Description: NF21184
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21184_low_45 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 31 - 242
Target Start/End: Complemental strand, 4164743 - 4164532
Alignment:
| Q |
31 |
aagacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatatttttgtcca |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164743 |
aagacaaactttttcaataggttgattgttcaccaccacccatggcacaaaagaatgaggtggatctagttttgctgtttcatcaatatatttttgtcca |
4164644 |
T |
|
| Q |
131 |
aactgcacacaaaattcaaatttattattaaggacattttaacaatctcacacaaggtatcatataaactataaccttggatgctagaagatctatctag |
230 |
Q |
| |
|
||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4164643 |
aactgtacacaaaattcaaatttattgttaaggacattttaacaatctcacacaaggtatcatataaactataaccttggatgctagaagatctatctag |
4164544 |
T |
|
| Q |
231 |
cacaagatattt |
242 |
Q |
| |
|
|||||||||||| |
|
|
| T |
4164543 |
cacaagatattt |
4164532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University