View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21185_high_1 (Length: 540)
Name: NF21185_high_1
Description: NF21185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21185_high_1 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 1e-39; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 1e-39
Query Start/End: Original strand, 250 - 402
Target Start/End: Complemental strand, 46851261 - 46851116
Alignment:
| Q |
250 |
cttcctgtataataataatcatggcggtgcttcaaattggacacgtcaatattcaatggccttctatctcctttgtgtttcaaattcaaactaatgctaa |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||| ||| | ||||||||||||||||||||||||||||| ||| |
|
|
| T |
46851261 |
cttcctgtataataataatcatggcggtgcttcaaattggacacgtcaatat--aat----ttcaa-ctcctttgtgtttcaaattcaaactaatggtaa |
46851169 |
T |
|
| Q |
350 |
accttccgctcgcannnnnnnattagaaattctattgtaaatctttgaggaaa |
402 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||| |||| |
|
|
| T |
46851168 |
accttccgctcgcatttttttattagaaattctattgtaaatctttgatgaaa |
46851116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University