View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21185_high_3 (Length: 341)
Name: NF21185_high_3
Description: NF21185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21185_high_3 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 302; Significance: 1e-170; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 302; E-Value: 1e-170
Query Start/End: Original strand, 1 - 335
Target Start/End: Complemental strand, 13137879 - 13137545
Alignment:
| Q |
1 |
ctttttctttggatatcaaaagggttgggagtgattatcttcatggcgggatagagggtattgcaaattcgggggtatacaaatcttgtataagtgttaa |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137879 |
cttttactttggatatcaaaagggttgggagtgattatcttcatggagggatagagggtattgcaaattcgggggtatacaaatcttgtataagtgttaa |
13137780 |
T |
 |
| Q |
101 |
acaagattacattatagagaccactattgcttcatatgataattcatacactgacaannnnnnngttctacaaatgaagaaaaagaaaaaccatgccaat |
200 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137779 |
acaagattacattatagagaccactattgtttcatatgataattcatacactgacaatttttttgttctacaaatgaagaaaaagaaaaaccatgccaat |
13137680 |
T |
 |
| Q |
201 |
gcttacatggtgactatggcacactattatgttaccaactttgctggtctttcttctgcagcaaaaatataccgtagtagaggaaaaggttttattgttg |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137679 |
gcttacatggtgactatggcacactattatgttaccaactttgctggtctttcttctgcagcaaaaatataccgtagtagaggaaaaggttttattgttg |
13137580 |
T |
 |
| Q |
301 |
aagtgaagggtccttacaaacatccaagtgatgat |
335 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
13137579 |
aagtgaagggtccttacaaacatccaagtgatgat |
13137545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University