View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21185_low_4 (Length: 259)
Name: NF21185_low_4
Description: NF21185
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21185_low_4 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 9 - 244
Target Start/End: Original strand, 33922111 - 33922336
Alignment:
| Q |
9 |
gaggaaattacaaggaaacttcgtgataaaatatctatataaaccttcattgatttcctctttcttcaacaaaaaatttcaatttcattttcatcaacaa |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33922111 |
gaggaaattacaaggaaacttcgtgataaaatatctatataaaccttcattgatttcctctttcttcaacaaaaaatttcaatttcattttcatcaacaa |
33922210 |
T |
 |
| Q |
109 |
taacaacaatgataggcaatgataggcattaggcaagacagaagtacaacacctggttgtcgtttcaaaggtataatatgctaaactttcacttttaaat |
208 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33922211 |
taacaacaat----------gataggcattaggcaagacagaagtacaacacctggttgtcgtttcaaaggtataatatgctaaactttcacttttaaat |
33922300 |
T |
 |
| Q |
209 |
cctcgttgttttttcttcattttataacttgttctt |
244 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
33922301 |
cctcgttgttttttcttcattttataacttgttctt |
33922336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University