View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21186_low_2 (Length: 275)
Name: NF21186_low_2
Description: NF21186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21186_low_2 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 30 - 271
Target Start/End: Original strand, 54432334 - 54432572
Alignment:
| Q |
30 |
tattttctattgtggaagttaacttttctccctttatatcctaaataaattcaactgtagaatttcaatgttgtttgttgaaggatagatttccattgcc |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||| |
|
|
| T |
54432334 |
tattttctattgtggaagttaacttttctccctttatatcctaaataaattcaactgtagaatttcaatgttgtttgttgaa---tagatttccatagcc |
54432430 |
T |
 |
| Q |
130 |
acacatgagcagaaggttgcatttttatgttgctggaaaagaggtgagagagaatacaaatgagagggcaaaataagagaatattttttgatgtggagag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||| |
|
|
| T |
54432431 |
acacatgagcagaaggttgcatttttatgttgctggaaaacaggtgagagagaatacaaatgagagggcaaaataagagaatatgttttggtgtagagag |
54432530 |
T |
 |
| Q |
230 |
aacatcataagatctataagtctactttatcctatgcttctc |
271 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
54432531 |
aacatcataagatctataagtctactttatccaatgattctc |
54432572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University