View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21186_low_4 (Length: 242)
Name: NF21186_low_4
Description: NF21186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21186_low_4 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 81; Significance: 3e-38; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 8 - 96
Target Start/End: Original strand, 50968202 - 50968290
Alignment:
| Q |
8 |
cgaagaatattgaagatgattttcttatagattacatgatttagaagatgatatcgctgaaaaatttaactcaaatacaacaattgatg |
96 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50968202 |
cgaagaagattgaagatgattttcttatagattacattatttagaagatgatatcgctgaaaaatttaactcaaatacaacaattgatg |
50968290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 150 - 242
Target Start/End: Original strand, 50968344 - 50968438
Alignment:
| Q |
150 |
ggatgtatcttataatttcttaagtttcatatatttat--atggatgattgaaatatttgagttggatcactgatggatgaacatggatgtatga |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50968344 |
ggatgtatcttataatttcttaagtttcatatatatatgtatggatgattgaaatatttgagttggatcactgatggatgaacatggatgtatga |
50968438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 16 - 53
Target Start/End: Original strand, 50970238 - 50970275
Alignment:
| Q |
16 |
attgaagatgattttcttatagattacatgatttagaa |
53 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
50970238 |
attgaagatgattttctcatagattacatgatttagaa |
50970275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 188 - 229
Target Start/End: Original strand, 22240745 - 22240786
Alignment:
| Q |
188 |
atggatgattgaaatatttgagttggatcactgatggatgaa |
229 |
Q |
| |
|
|||||||||||||||||||||||| ||| | ||||||||||| |
|
|
| T |
22240745 |
atggatgattgaaatatttgagtttgatgaatgatggatgaa |
22240786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University