View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21186_low_7 (Length: 223)

Name: NF21186_low_7
Description: NF21186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21186_low_7
NF21186_low_7
[»] chr1 (1 HSPs)
chr1 (63-110)||(50968416-50968463)


Alignment Details
Target: chr1 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 63 - 110
Target Start/End: Original strand, 50968416 - 50968463
Alignment:
63 gatggatgaacatggatgtatgaaatatttgagtacagttagctatac 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||    
50968416 gatggatgaacatggatgtatgaaatatttgagtacagttagctatac 50968463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University