View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21187_high_31 (Length: 211)
Name: NF21187_high_31
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21187_high_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 13627694 - 13627600
Alignment:
| Q |
45 |
gtatgaagcatggtggtggtaataaagtgtatgttgttaaaagggatatgatgtg---attcatttacatcattttagttttttctttcaattat |
136 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| ||||||| |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13627694 |
gtatgaagcatggtggtggtaaaaaagtgtttgttgttaaaatggatatggtgtgataattcatttgcatcattttagttttttctttcaattat |
13627600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 13627560 - 13627517
Alignment:
| Q |
153 |
ttttttattgtgagacaatgtttggatgctcatgaagatgtttt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13627560 |
ttttttattgtgagacaatgtttggatgctcatgaagatgtttt |
13627517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University