View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21187_low_16 (Length: 343)

Name: NF21187_low_16
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21187_low_16
NF21187_low_16
[»] chr4 (1 HSPs)
chr4 (206-343)||(56230175-56230312)


Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 206 - 343
Target Start/End: Complemental strand, 56230312 - 56230175
Alignment:
206 tgattcacaaactttgacatgaaattgcacaataaaatactatatggttaacaatgttcaaataaatatttgattagttacaatgttatctattaattaa 305  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||    
56230312 tgattcacaaactttgacataaaattgcacaataaaatactatatggttaacaatgttcaaataaatatttgattagtcacaatgttatctattaattaa 56230213  T
306 gaaacaaattaagaaggcttttgaactaattataaccc 343  Q
    |||| |||||||||||||||||||||||||||||||||    
56230212 gaaaaaaattaagaaggcttttgaactaattataaccc 56230175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University