View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21187_low_16 (Length: 343)
Name: NF21187_low_16
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21187_low_16 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 6e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 6e-65
Query Start/End: Original strand, 206 - 343
Target Start/End: Complemental strand, 56230312 - 56230175
Alignment:
| Q |
206 |
tgattcacaaactttgacatgaaattgcacaataaaatactatatggttaacaatgttcaaataaatatttgattagttacaatgttatctattaattaa |
305 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
56230312 |
tgattcacaaactttgacataaaattgcacaataaaatactatatggttaacaatgttcaaataaatatttgattagtcacaatgttatctattaattaa |
56230213 |
T |
 |
| Q |
306 |
gaaacaaattaagaaggcttttgaactaattataaccc |
343 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
56230212 |
gaaaaaaattaagaaggcttttgaactaattataaccc |
56230175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University