View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21187_low_21 (Length: 273)
Name: NF21187_low_21
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21187_low_21 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 187
Target Start/End: Original strand, 25933227 - 25933416
Alignment:
| Q |
1 |
ttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933227 |
ttaatttaaatgttttgtgactaagcatctcaataaatatccgtctcatagtcaaggagatggaataatgtttgattgttgtcgtttttattaaactaag |
25933326 |
T |
 |
| Q |
101 |
ttgaacgccctttctctaaaaatcagaaagttaacatcaaaacacaataat---ggtttgttcttgaaaaatgattaatttaacatacaa |
187 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
25933327 |
ttgaacgccctttctctgaaaatcagaaagttaacatcaaaatacaataattacggtttgttcttgaaaaatgattaatttaacatacaa |
25933416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University