View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21187_low_27 (Length: 248)
Name: NF21187_low_27
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21187_low_27 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 21 - 248
Target Start/End: Original strand, 39740906 - 39741134
Alignment:
| Q |
21 |
aactgagtctattttttgttcaacttttttgcttatttagctatgatatgaaactgacggtcattggtattgtacgaaaatgaagaattcatgttcacgg |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39740906 |
aactgagtctattttttgttcaacttttttgcttatttagctatgatatgaaactgacggtcattggtattgtacgaaaatgaagaattcatgttcacgg |
39741005 |
T |
|
| Q |
121 |
gctttattactttcnnnnnnnnnatataaatacatggactttatttgtgttgtgaaatgtgaatttggaaatat----acctttaatcagtagcatatct |
216 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39741006 |
gctttattactttc---ttttttatataaatacatggactttatttgtgttgtgaaatgtgaatttggaaatatactcacctttaatcagtagcatatct |
39741102 |
T |
|
| Q |
217 |
atgacgatagattacgcgtacaagttattttc |
248 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
39741103 |
atgacgatagattacgcgtacaagttattttc |
39741134 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University