View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21187_low_32 (Length: 224)

Name: NF21187_low_32
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21187_low_32
NF21187_low_32
[»] chr1 (1 HSPs)
chr1 (96-157)||(36020498-36020559)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 96 - 157
Target Start/End: Complemental strand, 36020559 - 36020498
Alignment:
96 cgttttacattacgtttatgaagacaaatccttgataattgaaaggttaaaccctaaaccgc 157  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
36020559 cgttttacattacgtttatgaagacaaatccttgataattgaaaggttaaaccctaaaccgc 36020498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University