View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21187_low_33 (Length: 211)

Name: NF21187_low_33
Description: NF21187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21187_low_33
NF21187_low_33
[»] chr2 (2 HSPs)
chr2 (45-136)||(13627600-13627694)
chr2 (153-196)||(13627517-13627560)


Alignment Details
Target: chr2 (Bit Score: 61; Significance: 2e-26; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 45 - 136
Target Start/End: Complemental strand, 13627694 - 13627600
Alignment:
45 gtatgaagcatggtggtggtaataaagtgtatgttgttaaaagggatatgatgtg---attcatttacatcattttagttttttctttcaattat 136  Q
    |||||||||||||||||||||| ||||||| ||||||||||| ||||||| ||||   |||||||| ||||||||||||||||||||||||||||    
13627694 gtatgaagcatggtggtggtaaaaaagtgtttgttgttaaaatggatatggtgtgataattcatttgcatcattttagttttttctttcaattat 13627600  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 13627560 - 13627517
Alignment:
153 ttttttattgtgagacaatgtttggatgctcatgaagatgtttt 196  Q
    ||||||||||||||||||||||||||||||||||||||||||||    
13627560 ttttttattgtgagacaatgtttggatgctcatgaagatgtttt 13627517  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University