View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21188_high_8 (Length: 236)
Name: NF21188_high_8
Description: NF21188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21188_high_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 34 - 219
Target Start/End: Original strand, 45612046 - 45612222
Alignment:
| Q |
34 |
tttctcttgaaccagtgcgatttaatttgtggttttggtaagtttgaatggagggagttttgaaagaaaaaaggagggataataaattttcatttaaaat |
133 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||| ||||||| ||||||||| ||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
45612046 |
tttctcttgaacccgtgcgatttaattt-----tttggaaagtttggatggaggga-ttttgaag---aaaaggagggattataaattttcatttaaaat |
45612136 |
T |
|
| Q |
134 |
tcatataatattttattagagatcaagatattactctcgataaacattgtattttgcccattttaactgttaaattaatagttttt |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45612137 |
tcatataatattttattagagatcaagatattcctctccataaacattgtattttgcccattttaactgttaaattaatagttttt |
45612222 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University