View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21188_high_9 (Length: 225)
Name: NF21188_high_9
Description: NF21188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21188_high_9 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 111; Significance: 3e-56; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 111; E-Value: 3e-56
Query Start/End: Original strand, 47 - 208
Target Start/End: Original strand, 35614623 - 35614787
Alignment:
| Q |
47 |
atccctcttgacatatattttttattttcaaaactcaacatctcgatccttccttttaataaaaatgctctcgatccttcgtttagaaagcaagctcttt |
146 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||| |||||||| |||| ||||| ||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
35614623 |
atccctcttgacatctattttttattttcaaaactcaatatctcgattcttctttttattaaaaatgctctccatccttcttttagaaagcaagctcttc |
35614722 |
T |
 |
| Q |
147 |
cac---ttacttatactttatatgtatttttaaaatcgtaatactatgttttgacctgttctcat |
208 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||| |
|
|
| T |
35614723 |
cacacattacttatactttatatgtatttttaaaatcgtaatactaggttttgaactgttctcat |
35614787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University