View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21189_high_2 (Length: 244)
Name: NF21189_high_2
Description: NF21189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21189_high_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 9 - 225
Target Start/End: Complemental strand, 36283001 - 36282786
Alignment:
| Q |
9 |
aggagtagcataggatattaacagacagatataactttaaaaaatggtctagttgtaagttgacttcgatgatgtaatcattgatttgcataaacataaa |
108 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36283001 |
aggagtaacattggatattaacagacagatataactttaaaaaatggtctagttgtaagttgacttcgatgatgtaatcattgatttgcataaacataaa |
36282902 |
T |
|
| Q |
109 |
tttggtcagtaggttttaatttttaaaannnnnnnnnggtcctatgcatagtttattttctgtttatataatatgaatatactaatgctcaagaaactgc |
208 |
Q |
| |
|
|||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
36282901 |
tttggtcagtaggttttaattttt-taatttttttttggtcctatgcatagtttattttctgtttatataatatgaatatactaatgctgaagaaactgc |
36282803 |
T |
|
| Q |
209 |
atgacgtttgtaattgg |
225 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
36282802 |
atgacgtttgtaattgg |
36282786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University