View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_high_10 (Length: 303)
Name: NF2118_high_10
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_high_10 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 1 - 296
Target Start/End: Original strand, 8570087 - 8570381
Alignment:
| Q |
1 |
tgggaagattagaaatggaatataatatagtgtttctgtttgcctatgaggaagaatgtgacctcgagtaggggtcatttatagttcaacatcaataatt |
100 |
Q |
| |
|
||||||||||| ||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8570087 |
tgggaagattataaatggaatataatatattgtttctgtttgcttatgagaaagaatgtgacctcgagtaggggtcatttatagttcaacatcaataatt |
8570186 |
T |
 |
| Q |
101 |
aatgaaagcaatcgaacaataaaagaagaagcagacaaggtagctgcttttttgatcatattcttctaataaaggctaattaagtaagtattatttgatt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
8570187 |
aatgaaagcaatcgaacaataaaagaagaagcagacaaggtagctgcttttttgatcatattcttctaataaaggctaattaagtaagtaata-ttgatt |
8570285 |
T |
 |
| Q |
201 |
catgtggtagctaagtaagtcatcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagggtattcatctc |
296 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8570286 |
catgtggtagctaagtaagtcatcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagggtattcatctc |
8570381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 285
Target Start/End: Original strand, 53748445 - 53748507
Alignment:
| Q |
223 |
tcaaaggggtcgagtatgtcttccagttgccctaccacaaagtaatgcattcttaggaatagg |
285 |
Q |
| |
|
||||||||| || |||||||| ||| |||||||||||||||| ||||||||| |||||||| |
|
|
| T |
53748445 |
tcaaagggggcgggtatgtctcccacttgccctaccacaaagacgtgcattctttggaatagg |
53748507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University