View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_high_18 (Length: 205)
Name: NF2118_high_18
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_high_18 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 179; Significance: 8e-97; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 179; E-Value: 8e-97
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 1223799 - 1223989
Alignment:
| Q |
1 |
cattcttccattcccatttcttgtttcttcttcttgaagcaaccaccacataatgcatcccttaaccctcttcactctcttctccaccttcatcctcacc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223799 |
cattcttccattcccatttcttgtttcttcttcttgaagcaaccgccacataatgcatcccttaaccctcttcactctcttctccaccttcatcctcacc |
1223898 |
T |
 |
| Q |
101 |
gcctccggtgccggtaacatccacctcgacttcccttacttcaccaccgcagacaccgccaccaacctcaccttcctcggcgattcatctc |
191 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1223899 |
gcctccggtgccggtaacatccacctcaacttcccttactttaccaccgcagacaccgccaccaacctcaccttcctcggcgattcatctc |
1223989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 176; Significance: 5e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 1 - 191
Target Start/End: Original strand, 41962322 - 41962515
Alignment:
| Q |
1 |
cattcttccattcccatttcttgtttct---tcttcttgaagcaaccaccacataatgcatcccttaaccctcttcactctcttctccaccttcatcctc |
97 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41962322 |
cattcttccattcccatttcttgtttcttcttcttcttgaagcaaccaccacataatgcatcccgtaaccctcttcactctcttctccaccttcatcctc |
41962421 |
T |
 |
| Q |
98 |
accgcctccggtgccggtaacatccacctcgacttcccttacttcaccaccgcagacaccgccaccaacctcaccttcctcggcgattcatctc |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41962422 |
accgcctccggtgccggtaacatccacctcgacttcccttacttcaccaccgcagacaccgccaccaacctcaccttcctcggcgattcatctc |
41962515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University