View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_high_4 (Length: 532)
Name: NF2118_high_4
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 262; Significance: 1e-146; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 17 - 290
Target Start/End: Complemental strand, 31262206 - 31261933
Alignment:
| Q |
17 |
actttgtaaccggttttgggtaaaccacattttttgaagagtgtggttttggggaacttgtttgtggcatagtttgatgaagaaggatcaaattcaaagg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
31262206 |
actttgtaaccggttttgggtaaaccacattttttgaagagtgtggttttggggaacttgtttgtggcatagtttgatgaagaagggtcgaattcaaagg |
31262107 |
T |
 |
| Q |
117 |
atttatatgcagcttcaacaaaatggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttg |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262106 |
atttatatgcagcttcaacaaaatggccataacgaaggatttcggaacgaagattattgtctaatgggtctaataaaccttcccaattggtcataccttg |
31262007 |
T |
 |
| Q |
217 |
gtattctttccatcttttgttaactttcgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
290 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31262006 |
gtattctttccatcttttgttaacttttgtagttggaaatggtaatggtgaaaatgttgattttgatgatgaaa |
31261933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 157; E-Value: 3e-83
Query Start/End: Original strand, 361 - 517
Target Start/End: Complemental strand, 31261862 - 31261706
Alignment:
| Q |
361 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
460 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261862 |
aagtgttatgcattgtggtttgatagtgaaggttgtggttttggggaaagaaatgtgggatgtagtgtggtttaaggatgtcattgtgattggtgagtga |
31261763 |
T |
 |
| Q |
461 |
gaaagagtgttgagaatggaaatgaatgagggaagtttgctactttgctatatgtgt |
517 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31261762 |
gaaagagtgttgagaatggaaatgaatgagggaagtttgctactttgctatatgtgt |
31261706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 98 - 159
Target Start/End: Complemental strand, 31304197 - 31304136
Alignment:
| Q |
98 |
gaaggatcaaattcaaaggatttatatgcagcttcaacaaaatggccataacgaaggatttc |
159 |
Q |
| |
|
||||||||||| ||||| |||||||| | ||||||||||||||||||||| || |||||||| |
|
|
| T |
31304197 |
gaaggatcaaactcaaatgatttatacgtagcttcaacaaaatggccatagcgtaggatttc |
31304136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University