View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_high_7 (Length: 386)
Name: NF2118_high_7
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_high_7 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 342; Significance: 0; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 342; E-Value: 0
Query Start/End: Original strand, 15 - 376
Target Start/End: Original strand, 36457142 - 36457503
Alignment:
| Q |
15 |
cataggggagtggattaataatgggtggtcatagaggctatcttggaagcgtaatgctattgattgggaggcctaactggtgcagaatttgaatacgctg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457142 |
cataggggagtggattaataatgggtggtcatagaggctatcttggaagcgtaatgctattgattgggaggcctaactggtgcagaatttgaatacgctg |
36457241 |
T |
|
| Q |
115 |
ctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagaatctacgcagagattcagctgcaaaagctgatgtagaatgctgtc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457242 |
ctgctgtcagcgtctccaaggcaggaccagcctgatactgggtctggaaactagagtctacacagagattcagctgcaaaagctgatgtagaatgctgtc |
36457341 |
T |
|
| Q |
215 |
agatttatatgcaggcgacgagtttagagcagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgggtggaagctcctgcagaagaggct |
314 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
36457342 |
agatttatatgcaggcgacgagtttaaagtagcatatcacctaatttggcgatgtgtcgaaagtccaggttttcgtgtggaagctcctgcagaagaggct |
36457441 |
T |
|
| Q |
315 |
gcagtcaatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
376 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36457442 |
gcagtcaatgttgaatttaatcacaagaaacattatgcctgcggatcataattcatcctttg |
36457503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University