View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_low_17 (Length: 268)
Name: NF2118_low_17
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 267
Target Start/End: Original strand, 12513575 - 12513826
Alignment:
| Q |
16 |
atgggttagggttggcctaaggttttgctagagtttatggacataactttcttctttttatacataagataagataagttagtgtactattatatttaac |
115 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
12513575 |
atgggttagggttgacctaaggttttgctagagtttatggacataactttcttctttttatacataagataagataagttagtgtacttttatatttaac |
12513674 |
T |
|
| Q |
116 |
tacgataaaagtgtagagttcaatatcccatataagaacttttgtataaaaattagtagtaaaatgaaagaaacttatcatttgaaaaatgaatttattc |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12513675 |
tacgataaaagtgtagagttcaatatcccatataagaacttttgtataaaaattagtagtaaaatgaaagaaacttatcatttgaaaaatgaatttattc |
12513774 |
T |
|
| Q |
216 |
tctattcttcttgttttttcactttgagtttttatagtaactatatagagaa |
267 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12513775 |
tctattcttcttgttttttcactttgagtttttatagtaactatatagagaa |
12513826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 20 - 82
Target Start/End: Complemental strand, 39289668 - 39289606
Alignment:
| Q |
20 |
gttagggttggcctaaggttttgctagagtttatggacataactttcttctttttatacataa |
82 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||| || || ||||||| ||||||| |||| |
|
|
| T |
39289668 |
gttaggattggcctagagttttgctagagtttatgggcagaattttcttccttttatatataa |
39289606 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University