View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_low_20 (Length: 227)
Name: NF2118_low_20
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_low_20 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 90; Significance: 1e-43; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 18 - 119
Target Start/End: Complemental strand, 24134887 - 24134786
Alignment:
| Q |
18 |
gatacaacatcaattgttcaacttccatctctaaggtaaagttttgtttgatattatctataacttggtataatttcaaaattatttatccatggtattt |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24134887 |
gatacaacatcaattgttcaacttccatctctaaggtaaaattttgtttgatattatctataacttggtataatttcaaaattatttacacatggtattt |
24134788 |
T |
|
| Q |
118 |
tt |
119 |
Q |
| |
|
|| |
|
|
| T |
24134787 |
tt |
24134786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 139 - 205
Target Start/End: Complemental strand, 24134368 - 24134302
Alignment:
| Q |
139 |
ttattttattttattcagtacctttaaaaacaatttcaatttttaatatttcactttcatatgtata |
205 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24134368 |
ttattttattttattcagtacccttaaaaacaatttcaatttttaatatttcactttcatatgtata |
24134302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 18 - 56
Target Start/End: Complemental strand, 19757006 - 19756968
Alignment:
| Q |
18 |
gatacaacatcaattgttcaacttccatctctaaggtaa |
56 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
19757006 |
gatacaacatcaattgttcaacttcaatctctaaggtaa |
19756968 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 180 - 209
Target Start/End: Complemental strand, 19756558 - 19756529
Alignment:
| Q |
180 |
tttaatatttcactttcatatgtataatat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19756558 |
tttaatatttcactttcatatgtataatat |
19756529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University