View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_low_21 (Length: 220)
Name: NF2118_low_21
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_low_21 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 123; Significance: 2e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 2e-63
Query Start/End: Original strand, 23 - 197
Target Start/End: Original strand, 54221008 - 54221182
Alignment:
| Q |
23 |
aacaaattgatatacttgtgctgtgaacttcacatatatatatcaacataaataaaagcatctatnnnnnnnnnttaagtaaaagcaatgtctatcagat |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
54221008 |
aacaaattgatatacttgtgctgtgaacttcacatatatatatcaacataaataaaagcatctataaaaaaaaattaagtaaaagcaatgtctatcagat |
54221107 |
T |
|
| Q |
123 |
tactaccgtgtccaaactcaaacaaatgtctgataaatgcaacnnnnnnntaaagatttatttgaatgcgacaac |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54221108 |
tactaccatgtccaaactcaaacaaatgtctgataaatgcaacaaaaaaataaagatttatttgaatgcgacaac |
54221182 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University