View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2118_low_8 (Length: 396)
Name: NF2118_low_8
Description: NF2118
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2118_low_8 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 197; Significance: 1e-107; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 185 - 389
Target Start/End: Original strand, 35245181 - 35245385
Alignment:
| Q |
185 |
tttgcgtgtcatgcataaattattttggattggagtgtcaaccttttagggagttacgttgattgtagcatgcctagactactttcgattagatttagtt |
284 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35245181 |
tttgcgtgtcatgcataaattattttggattggagtgtcaaccttttagggagttacgttgattgtagcatgcctagactactttcgattagatttagtt |
35245280 |
T |
 |
| Q |
285 |
ccaacatttttgctctatagacgataaaattatagtatggttaaaatattctgttttgtgctttaaatataacatacttggttttgatctctataaattc |
384 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35245281 |
ccaacatttttgctctatagacgataaaattatagtatggttaaaatattttgttttgtgctttaaatataacatacttggttttgatctctataaattc |
35245380 |
T |
 |
| Q |
385 |
ttctc |
389 |
Q |
| |
|
|||| |
|
|
| T |
35245381 |
atctc |
35245385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 154; E-Value: 1e-81
Query Start/End: Original strand, 18 - 183
Target Start/End: Original strand, 35245039 - 35245204
Alignment:
| Q |
18 |
ctgtttgctgcatagtaagcaacttgtgaaagaaaaaccatcccttaagccacggattcaatctcaattttgggatacgagtcgtattgctgtctcattt |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35245039 |
ctgtttgttgcatagtaagcaacttgtgaaagaaaaaccatcccttaagccacggattcaatctcaattttgggatacgagtcgtattgctgtctcattt |
35245138 |
T |
 |
| Q |
118 |
tgctgcatgatgtatgctgaaacattgcatgattccatgcattttgtgtgtcatgcataaattatt |
183 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
35245139 |
tgctgcatgatgtatgctgaagcattgcatgattccatgcattttgcgtgtcatgcataaattatt |
35245204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University