View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21191_high_13 (Length: 242)
Name: NF21191_high_13
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21191_high_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 114 - 226
Target Start/End: Complemental strand, 30565505 - 30565393
Alignment:
| Q |
114 |
ttcgattatttcattaattgaatgcttgtgtaaaacttttttaccaacaaaatgtttctagttgattatggttataagaatggtgnnnnnnnnataaata |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||| ||||||| |
|
|
| T |
30565505 |
ttcgattatttcattaattgaatgcttgtgtaaaacttttttactaacaaaatgtttctagttgattatgattataagaatggtgttttttttataaata |
30565406 |
T |
 |
| Q |
214 |
ttttagtgaaatc |
226 |
Q |
| |
|
||||||||||||| |
|
|
| T |
30565405 |
ttttagtgaaatc |
30565393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University