View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21191_high_15 (Length: 233)

Name: NF21191_high_15
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21191_high_15
NF21191_high_15
[»] chr2 (2 HSPs)
chr2 (153-217)||(43763782-43763846)
chr2 (20-59)||(43763949-43763988)


Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 43763846 - 43763782
Alignment:
153 attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43763846 attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat 43763782  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 43763988 - 43763949
Alignment:
20 tctgatctgttcagaagtgtgcctgtgatatttcttcctt 59  Q
    ||||||||||||||||||||||||||||||||||||||||    
43763988 tctgatctgttcagaagtgtgcctgtgatatttcttcctt 43763949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University