View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21191_high_15 (Length: 233)
Name: NF21191_high_15
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21191_high_15 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 43763846 - 43763782
Alignment:
| Q |
153 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763846 |
attgatttggatttagctggacctgaatactcactgctaatttcctccacacgctcacctcctat |
43763782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 20 - 59
Target Start/End: Complemental strand, 43763988 - 43763949
Alignment:
| Q |
20 |
tctgatctgttcagaagtgtgcctgtgatatttcttcctt |
59 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43763988 |
tctgatctgttcagaagtgtgcctgtgatatttcttcctt |
43763949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University