View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21191_high_9 (Length: 255)
Name: NF21191_high_9
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21191_high_9 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 18 - 145
Target Start/End: Complemental strand, 30565860 - 30565733
Alignment:
| Q |
18 |
tgaagatgtttgtgttattctgtttgttgctaatacaagtttcactttctgaagtcatcttcgaagagcgttttgaaggtaatttatttattctatgctc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30565860 |
tgaagatgtttgtgttattctgtttgttgctaatacaagtttcactttctgaagtcatcttcgaagagcgttttgaaggtaatttatttattctatgctc |
30565761 |
T |
|
| Q |
118 |
ttttgttgctgaaattttgattccaacg |
145 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
30565760 |
ttttgttgctgaaattttgactccaacg |
30565733 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University