View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21191_low_11 (Length: 275)
Name: NF21191_low_11
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21191_low_11 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 15 - 275
Target Start/End: Original strand, 25997539 - 25997799
Alignment:
| Q |
15 |
gactaagaaatagaaaaattaaaatgaatggacacttacttttaaccagtttcataacataattttaatctgctcaactattctatccaccgtccatgaa |
114 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25997539 |
gactaagaaatagaaagattaaaatgaacggacacttacttttaaccagtttcataacataatttaaatctcctccactattctatccaccgtccatgaa |
25997638 |
T |
 |
| Q |
115 |
gaattctgaagcagtgttttatttcttaatttccatattatccaaacacttgcaaaccaaattgttgaaatccttgtgtggtattatacctccttttgga |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997639 |
gaattctgaagcagtgttttatttcttaatttccatattatccaaacacttgcaaaccaaattgttgaaatccttgtgtggtattatacctccttttgga |
25997738 |
T |
 |
| Q |
215 |
acaaactcatgaattacagattcatagctttaacactaattgatgttaatttaagattgct |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25997739 |
acaaactcatgaattacagattcatagctttaacactaattgatgttaatttaagattgct |
25997799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University