View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21191_low_16 (Length: 242)

Name: NF21191_low_16
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21191_low_16
NF21191_low_16
[»] chr7 (1 HSPs)
chr7 (114-226)||(30565393-30565505)


Alignment Details
Target: chr7 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 114 - 226
Target Start/End: Complemental strand, 30565505 - 30565393
Alignment:
114 ttcgattatttcattaattgaatgcttgtgtaaaacttttttaccaacaaaatgtttctagttgattatggttataagaatggtgnnnnnnnnataaata 213  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||        |||||||    
30565505 ttcgattatttcattaattgaatgcttgtgtaaaacttttttactaacaaaatgtttctagttgattatgattataagaatggtgttttttttataaata 30565406  T
214 ttttagtgaaatc 226  Q
    |||||||||||||    
30565405 ttttagtgaaatc 30565393  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University