View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21191_low_17 (Length: 240)
Name: NF21191_low_17
Description: NF21191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21191_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 13 - 221
Target Start/End: Original strand, 6373329 - 6373537
Alignment:
| Q |
13 |
tgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaactccacgaaact |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6373329 |
tgacatggatccgacttgtgtggcacatcgtctagagcgccgtccctaagatgatgcattgcattgcatgcacggaacaaaaagtaaactccacgaaact |
6373428 |
T |
|
| Q |
113 |
tcaactaaaatgactttaaacatggtagtagtatttttgttctccccagcgatgcaaactcacatgcccctcttaggcttgtgccccttccgcatatttt |
212 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6373429 |
tcaactaaaatgactttaaacatgggagtagtatttttgttctccccaacgatgcaaattcacatgcccctcttaggcttgtgccccttccgcatatttt |
6373528 |
T |
|
| Q |
213 |
gccaacaat |
221 |
Q |
| |
|
||||||||| |
|
|
| T |
6373529 |
gccaacaat |
6373537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University