View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21192_high_5 (Length: 251)
Name: NF21192_high_5
Description: NF21192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21192_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 9 - 214
Target Start/End: Complemental strand, 43551215 - 43551010
Alignment:
| Q |
9 |
aagcaaagggaagatgttagtgtttgacatttggtacgtgacgtatggtcctaatttctgatgcagtcttctctttttatctctcttcttacataatttc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
43551215 |
aagcaaagggaagatgttagtgtttgacatctggtacgtgacgtatggtcctaatttctgatgtagtattctctttttatctctcttcttacataatttc |
43551116 |
T |
 |
| Q |
109 |
acaagcttgtcttttatattggctatacataaacaacacgttgtaattttgtataatgcttcaaatttcacacgtactactgagattggcacaaaccata |
208 |
Q |
| |
|
| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
43551115 |
atgagcttgtcttttatattggctatacatacacaacacgttgtaattttgtataatgcttcaaatttcacacgtaccactgagattggcacaaaccata |
43551016 |
T |
 |
| Q |
209 |
tatagt |
214 |
Q |
| |
|
|||||| |
|
|
| T |
43551015 |
tatagt |
43551010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University