View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21192_high_7 (Length: 238)
Name: NF21192_high_7
Description: NF21192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21192_high_7 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 37055222 - 37055002
Alignment:
| Q |
18 |
gaactcaccatttcctttgaaggcgaggtttatgttttcccttccgttacgccagaaaaggttcaattttttacagtttttatttcttcccccatcgatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055222 |
gaactcaccatttcctttgaaggcgaggtttatgttttcccttccgttacgccagaaaaggttcaattttttacagtttttatttcttcccccatcgatc |
37055123 |
T |
 |
| Q |
118 |
aattgaagttttttgtgttacgaactgaaatgcttgaatttgaattaccatagctaaataaattttgaaaattttgaactttttgttctgataatgcact |
217 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37055122 |
aattgaagttttttgtgttatgaactgaaatgcttgaatttgaattaccatagccaaataaattttgaaaattttgaactttttgttctgataatgcact |
37055023 |
T |
 |
| Q |
218 |
ctaggcaataaagtttaaggt |
238 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
37055022 |
ctatgcaataaagtttaaggt |
37055002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University