View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21192_low_8 (Length: 213)
Name: NF21192_low_8
Description: NF21192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21192_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 94; Significance: 5e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 94; E-Value: 5e-46
Query Start/End: Original strand, 51 - 194
Target Start/End: Complemental strand, 34358578 - 34358436
Alignment:
| Q |
51 |
gttgtagtgtcaaagacaggtagatgtgtgtgtatgacaacattaatcgttctcttcttcctttttaaacattttggttcctttatcttgtannnnnnnn |
150 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| | |
|
|
| T |
34358578 |
gttgtagtgtcaaagacaggtagatgtgtgtgtatgacaacattaatcgttctcttcttcctttttaaacattttggttccattatcttgca-ttttttt |
34358480 |
T |
|
| Q |
151 |
nnngtttcctttctatatttgtgggtcagtcaacgggtgatatt |
194 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34358479 |
tttgtttcctttctatatttgttggtcagtcaacgggtgatatt |
34358436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 51 - 140
Target Start/End: Complemental strand, 34352939 - 34352854
Alignment:
| Q |
51 |
gttgtagtgtcaaagacaggtagatgtgtgtgtatgacaacattaatcgttctcttcttcctttttaaacattttggttcctttatcttg |
140 |
Q |
| |
|
||||||||||||||||||||||| |||||||| ||| ||||| | ||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
34352939 |
gttgtagtgtcaaagacaggtaggtgtgtgtg----acagcattagttgttctcttcttcctttttaaacattttggtttctttatcttg |
34352854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University