View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21193_high_43 (Length: 250)
Name: NF21193_high_43
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21193_high_43 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 6 - 237
Target Start/End: Original strand, 27143236 - 27143468
Alignment:
| Q |
6 |
caatcactattgtgtcgtgatccgctatttagtacaatgttgtcaaatagccgttattgtggcgctctatagtgttaacaaacacactatattttgcg-a |
104 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
27143236 |
caatcactattgtgtcatgatccgctatttagtacaatgttgtcaaatagccgttattgtggcgctctatagtgtcaacaaacacactatattttgcgca |
27143335 |
T |
|
| Q |
105 |
tcagcgattgacaagaatgagcaaaaatagtgataaaatatgggaagtacctggcgaggaccaaagcctactgcagaaaatttatctttcatttcctgaa |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27143336 |
tcagcgatcgacaagaatgagcaaaaatagtgataaaatatgggaagtacctggcgaggaccaaagcctactgcagaaaatttatctttcatttcctgaa |
27143435 |
T |
|
| Q |
205 |
cacttgctttctcccaaagtggaattctcccct |
237 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
27143436 |
cacttgctttctcccaaagtggaattctcccct |
27143468 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 7 - 71
Target Start/End: Complemental strand, 26445568 - 26445502
Alignment:
| Q |
7 |
aatcactattgtgtcgtgatccgctatttagtacaa--tgttgtcaaatagccgttattgtggcgct |
71 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||||| ||||||||||||| ||||| |||||||| |
|
|
| T |
26445568 |
aatcacttttgtttcgtgatccactatttagtacaaagcgttgtcaaatagcagttatagtggcgct |
26445502 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 24 - 67
Target Start/End: Original strand, 34417360 - 34417405
Alignment:
| Q |
24 |
gatccgctatttagtacaa--tgttgtcaaatagccgttattgtgg |
67 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||| |||||||| |
|
|
| T |
34417360 |
gatccgctatttagtacaaagtgttgtcaaatagccgctattgtgg |
34417405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University