View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21193_high_44 (Length: 250)

Name: NF21193_high_44
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21193_high_44
NF21193_high_44
[»] chr7 (2 HSPs)
chr7 (152-234)||(42036590-42036672)
chr7 (1-78)||(42036746-42036823)


Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 152 - 234
Target Start/End: Complemental strand, 42036672 - 42036590
Alignment:
152 tgtttgttgattatgctactcctcgcaagctagcctgcaaaggcaagcgcgatgagattgaggaattaaagaggcgtcaaatg 234  Q
    |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42036672 tgtttgttgattatgccactcctcgcaagctagcctgcaaaggcaagcgcgatgagattgaggaattaaagaggcgtcaaatg 42036590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 42036823 - 42036746
Alignment:
1 aatgatttgcccaagttcatcaacgttatgaagtggttgaatggtactcaacaaggtaagaaagctatggctgatact 78  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42036823 aatgatttgcccaagttcatcaacgttatgaagtggttgaatggtactcaacaaggtaagaaagctatggctgatact 42036746  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University