View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21193_high_50 (Length: 235)
Name: NF21193_high_50
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21193_high_50 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 2466681 - 2466460
Alignment:
| Q |
1 |
gtgagaaaaggactgagaaagagatggagaaagaaggaggtgttgaggatgtgaaaatgaatgatatgttttggagattgagtttgcctgaagattcgga |
100 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466681 |
gtgagaaaaggactgagaaagagatggaggaagaaggaggtgttgaggatgtgaaaatgaatgatatgttttggagattgagtttgcctgaagattcgga |
2466582 |
T |
|
| Q |
101 |
ccgcaannnnnnnggttgtaattttgagaaagatgatgtgagtgagagtgtttggttgaagtttcctgctgttgaggtttatgttgctggaaaggatttt |
200 |
Q |
| |
|
|||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2466581 |
ccgcgatttttttggttgtaattttgagaaagatgatgtgagtgagagtgtttggttgaagtttcctgctgttgaggtttatgttgctggaaaggatttt |
2466482 |
T |
|
| Q |
201 |
ttgaaggaaagaggtgttatgt |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
2466481 |
ttgaaggaaagaggtgttatgt |
2466460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University