View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21193_high_52 (Length: 230)
Name: NF21193_high_52
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21193_high_52 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 215
Target Start/End: Original strand, 55138615 - 55138829
Alignment:
| Q |
1 |
tccaggtgttctttcgatggcaaatgcaggacccggtacgaatggatcgcagttctttatatgcacggcgaagacggagtggcttgacgggaagcatgtg |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
55138615 |
tccaggtgttctttcgatggcaaatgcaggacccggtacgaatggatcgcagttctttatatgcacggcaaagacggagtggcttgacgggaagcatgtg |
55138714 |
T |
|
| Q |
101 |
gtttttggtgaggtggttgaaggaatggaggtggtgaaagtgattgagaaagttggttccggttcgggaaaaacatcaaagccagtggttattgctgact |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55138715 |
gtttttggtgaggtggttgaaggaatggaggtggtgaaagagattgagaaagttggttccggttcgggaaaaacatcaaagccagtggttattgctgact |
55138814 |
T |
|
| Q |
201 |
gcggccaactctctg |
215 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
55138815 |
gcggccaactctctg |
55138829 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 35; Significance: 0.00000000008; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 44 - 186
Target Start/End: Complemental strand, 28754431 - 28754289
Alignment:
| Q |
44 |
ggatcgcagttctttatatgcacggcgaagacggagtggcttgacgggaagcatgtggtttttggtgaggtggttgaaggaatggaggtggtgaaagtga |
143 |
Q |
| |
|
||||| |||||||| || ||||| || ||||| ||||||||||||||||| || || || || ||| |||| |||||||| |||| | ||||| | || |
|
|
| T |
28754431 |
ggatctcagttcttcatctgcaccgctaagaccgagtggcttgacgggaaacacgtcgtgttcggtcaggttgttgaaggtctggacatcgtgaaggaga |
28754332 |
T |
|
| Q |
144 |
ttgagaaagttggttccggttcgggaaaaacatcaaagccagt |
186 |
Q |
| |
|
| ||||||||||| || || || ||||| || ||||||||||| |
|
|
| T |
28754331 |
tcgagaaagttggatctggatctggaaagacctcaaagccagt |
28754289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University