View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21193_high_54 (Length: 225)

Name: NF21193_high_54
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21193_high_54
NF21193_high_54
[»] chr7 (1 HSPs)
chr7 (18-183)||(28862513-28862678)


Alignment Details
Target: chr7 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 183
Target Start/End: Complemental strand, 28862678 - 28862513
Alignment:
18 aatttgatcgatcgcgtttgattttacacaattgtgtttgggattgggaggaagtgaggaatgagaaggaggaagggatgtaactcagtgtgtgactgac 117  Q
    ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28862678 aatttgatcaatcgcgtttgattttacacaattgtgtttgggattgggaggaagtgaggaatgagaaggaggaagggatgtaactcagtgtgtgactgac 28862579  T
118 cacgggcttatcgtagggttcactaatttctaattatcctattggttggttgactcatattaataa 183  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
28862578 cacgggcttatcgtagggttcactaatttctaattatcctattggttggttgactcatattaataa 28862513  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University