View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21193_high_57 (Length: 214)
Name: NF21193_high_57
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21193_high_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 16 - 199
Target Start/End: Original strand, 11826644 - 11826827
Alignment:
| Q |
16 |
cactaattaatcatgtttcttaatgcgtacacacgagtagctattctatatatttgagatctttatatgcgatacataaattgccaaaggatgattagtt |
115 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
11826644 |
cactaattaatcatgtttcttaatgcatacacacgagtagctattctatatatttgagatctttatatgcgatacataaattgccaaaggataattagtt |
11826743 |
T |
|
| Q |
116 |
gcccttccatataggttaagatcttgagggttttcagctatgacctaactagtagttaggtctaagatgaaccattttgccttt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11826744 |
gcccttccatataggttaagatcttgagggttttcagctatgacctaactagtagttaggtctaagatgaaccattttgccttt |
11826827 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 70 - 180
Target Start/End: Original strand, 11840528 - 11840641
Alignment:
| Q |
70 |
tgagatctttatatgcgatacataaattgccaaaggatgattagttgcccttccatataggttaagatcttgagggt---tttcagctatgacctaacta |
166 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||| ||| ||||||||||| |||||||||||||||||||||| ||||| | |||||||| || |
|
|
| T |
11840528 |
tgagatctttatataggatacataaattgccaaaggatcattggttgcccttccttataggttaagatcttgagggtttctttcaaccatgacctagctt |
11840627 |
T |
|
| Q |
167 |
gtagttaggtctaa |
180 |
Q |
| |
|
|||| ||||||||| |
|
|
| T |
11840628 |
gtagctaggtctaa |
11840641 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University