View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21193_low_45 (Length: 250)
Name: NF21193_low_45
Description: NF21193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21193_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 79; Significance: 5e-37; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 152 - 234
Target Start/End: Complemental strand, 42036672 - 42036590
Alignment:
| Q |
152 |
tgtttgttgattatgctactcctcgcaagctagcctgcaaaggcaagcgcgatgagattgaggaattaaagaggcgtcaaatg |
234 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42036672 |
tgtttgttgattatgccactcctcgcaagctagcctgcaaaggcaagcgcgatgagattgaggaattaaagaggcgtcaaatg |
42036590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Complemental strand, 42036823 - 42036746
Alignment:
| Q |
1 |
aatgatttgcccaagttcatcaacgttatgaagtggttgaatggtactcaacaaggtaagaaagctatggctgatact |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42036823 |
aatgatttgcccaagttcatcaacgttatgaagtggttgaatggtactcaacaaggtaagaaagctatggctgatact |
42036746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University