View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21194_high_15 (Length: 305)
Name: NF21194_high_15
Description: NF21194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21194_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 95 - 242
Target Start/End: Original strand, 45909605 - 45909755
Alignment:
| Q |
95 |
agtctacaatgaattataaatccaaaatattgaccagaaaaaactcacggtgggtcccatgtcacg---gaaccaagagtcattggcgctgatctcgaca |
191 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
45909605 |
agtctacaatgaattataaatccaaactattgaccagaaaaaactcacggtgggtcccatgtcacgacggaaccaagaatcattggcgctgatctcgaca |
45909704 |
T |
 |
| Q |
192 |
attctaacatgatccggaagctgactccgtgcattctcccactgatatcat |
242 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45909705 |
attctaacatgatccggaagctgactcggtgcattctcccactgatatcat |
45909755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 133 - 243
Target Start/End: Original strand, 45916163 - 45916273
Alignment:
| Q |
133 |
aaaaactcacggtgggtcccatgtcacggaaccaagagtcattggcgctgatctcgacaattctaacatgatccggaagctgactccgtgcattctccca |
232 |
Q |
| |
|
|||||||||| |||||||| |||||||| |||||||| || |||| ||| ||||| || | ||||||||||| || |||||| |||| ||||||||||| |
|
|
| T |
45916163 |
aaaaactcacagtgggtccaatgtcacgaaaccaagaatcgttggagctaatctcaacgaccctaacatgatcaggtagctgattccgcgcattctccca |
45916262 |
T |
 |
| Q |
233 |
ctgatatcatg |
243 |
Q |
| |
|
|| | |||||| |
|
|
| T |
45916263 |
ctaaaatcatg |
45916273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 34607257 - 34607204
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34607257 |
tgttgagaatatggatcagaacctattattagagtttattgcagtattcctatg |
34607204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 245 - 295
Target Start/End: Complemental strand, 34632349 - 34632299
Alignment:
| Q |
245 |
tgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||| |||||||||||| |
|
|
| T |
34632349 |
tgagaatatggatcagaacctattattggagtttattgtagtattcctatg |
34632299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 253 - 295
Target Start/End: Original strand, 34607266 - 34607308
Alignment:
| Q |
253 |
tggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
34607266 |
tggatcagaacctattattagagtttattgctgtattcctatg |
34607308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 50; Significance: 1e-19; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 23435154 - 23435101
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23435154 |
tgttgagaatatggatcagaacctattattagagtttattgcagtattcctatg |
23435101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 241 - 295
Target Start/End: Complemental strand, 26713043 - 26712989
Alignment:
| Q |
241 |
atgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26713043 |
atgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
26712989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 26708791 - 26708738
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26708791 |
tgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
26708738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 46; Significance: 3e-17; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 9791464 - 9791411
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9791464 |
tgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
9791411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 9795803 - 9795750
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9795803 |
tgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
9795750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 45994925 - 45994872
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45994925 |
tgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
45994872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 242 - 295
Target Start/End: Complemental strand, 45999178 - 45999125
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtattcctatg |
295 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
45999178 |
tgttgagaatatggatcagaacctattattagagtttattgtagtattcctatg |
45999125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 242 - 289
Target Start/End: Original strand, 26763489 - 26763536
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtatt |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26763489 |
tgttgagaatatggatcagaacctattattagagtttattgtagtatt |
26763536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 242 - 289
Target Start/End: Original strand, 26767741 - 26767788
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtatt |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
26767741 |
tgttgagaatatggatcagaacctattattagagtttattgtagtatt |
26767788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 242 - 289
Target Start/End: Complemental strand, 35926713 - 35926666
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtatt |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35926713 |
tgttgagaatatggatcagaacctattattagagtttattgtagtatt |
35926666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 242 - 289
Target Start/End: Complemental strand, 35930962 - 35930915
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtatt |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
35930962 |
tgttgagaatatggatcagaacctattattagagtttattgtagtatt |
35930915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 242 - 289
Target Start/End: Complemental strand, 27695263 - 27695216
Alignment:
| Q |
242 |
tgttgagaatatggatgagaacctattattagagtttattgcagtatt |
289 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
27695263 |
tgttgagaatatggatcagaacctattattagagtttgttgtagtatt |
27695216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University