View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21194_high_7 (Length: 402)
Name: NF21194_high_7
Description: NF21194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21194_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 180; Significance: 4e-97; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 180; E-Value: 4e-97
Query Start/End: Original strand, 188 - 387
Target Start/End: Original strand, 37991859 - 37992057
Alignment:
| Q |
188 |
taacatgtgaaaatataacggaaagaattaatggaagtgtcctccgtgttgccgatttgcaccacaacaccgctttggatagggaccagcctggaataaa |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37991859 |
taacatgtgaaaatataacggaaagaattaatggaagtgtcctccttgttgccgatttgcaccacaacaccgctt-ggatagggaccagcctggaataaa |
37991957 |
T |
 |
| Q |
288 |
ggtcgtagaaactataaggcacatgaaacagaatgagaagtatataaatataaatatttgacttattaaatgtacttctgttttttgaagggctaaatgt |
387 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37991958 |
ggtcgtagaaactataaggcacatgaaacagaatgacaagtatataaatataaatatttgacttattaaatgtacttctgtttttttaagggctaaatgt |
37992057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 15 - 139
Target Start/End: Original strand, 37991686 - 37991810
Alignment:
| Q |
15 |
ggcatccaaactttacactaaagaagacactaccttttgaattgttatatcttcaatttcaattaatttatgccctaaatatacaaaatttgaaatgatt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37991686 |
ggcatccaaactttacactaaagaagacactaccttttgaattgttatatcttcaatttcaattaatttatgccctaaatatacaaaatttgaaatgatt |
37991785 |
T |
 |
| Q |
115 |
attagcttgcaattgcatgcataaa |
139 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
37991786 |
attagcttgcaattgcatgcataaa |
37991810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University